View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3536_high_40 (Length: 232)
Name: NF3536_high_40
Description: NF3536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3536_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 47637011 - 47636845
Alignment:
| Q |
1 |
ccgttagtgttggtatgggtcggattgatgaggaaaagcctagtgatgatgatattgctgaaggtgatgttcctgtggtggcaaattcttatccaagaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47637011 |
ccgttagtgttggtatgggtcggattgatgaggaaaagcctagtgatgatgatattgctgaaggtgatgttcctgtggtggcaaattcttatccaagaag |
47636912 |
T |
 |
| Q |
101 |
tagaagctatgctgttggaaagagaaatgttgttttgtagaatcattaaaattaatctctcttgaga |
167 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47636911 |
tagaagctatgctgttggaaagagaagtgttgttttgtagaatcattaaaattaatctctcttgaga |
47636845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University