View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3536_low_30 (Length: 248)
Name: NF3536_low_30
Description: NF3536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3536_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 4326959 - 4327171
Alignment:
| Q |
1 |
ccacggcagcctcaaagtatacgacatcttcccacaaatagtgagcttgaaatcggaggattaacatctaaaaaatatattgtatcggttttcattcnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
4326959 |
ccacggcagcctcaaagtatacgacatcttcc-acaaatagtgagcttgaaatcggaggattaacatctaaaaaatatatagtaaaggttttcattcttt |
4327057 |
T |
|
| Q |
101 |
nnnngaactatcaaattcttcattcttattgaacat-aatgtaaaactagttgtagtttacatgaccgtccatgtccccttttctcatattataactgag |
199 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4327058 |
ttttgaactatcaaattcttcattcttattggacatcaatataaaactagttgtagtttacatgactgtccatgtccccttttctcatattataactgag |
4327157 |
T |
|
| Q |
200 |
ttatttgtttagta |
213 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4327158 |
ttatttgtttagta |
4327171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 138 - 209
Target Start/End: Original strand, 4330722 - 4330795
Alignment:
| Q |
138 |
atgtaaaactagttgtagt--ttacatgaccgtccatgtccccttttctcatattataactgagttatttgttt |
209 |
Q |
| |
|
|||||||||||||| |||| |||| |||| |||||||||||||||||||||| ||||| |||| ||||||||| |
|
|
| T |
4330722 |
atgtaaaactagttatagtgtttacgtgacggtccatgtccccttttctcatactataaatgagctatttgttt |
4330795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University