View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3536_low_34 (Length: 240)
Name: NF3536_low_34
Description: NF3536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3536_low_34 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 4547887 - 4547665
Alignment:
| Q |
18 |
caagggaacatcgaatactgcttcaacttcggctgaatctaaaattggtgaaaatgcatcattgttggacaatattccaactactggtattattgtgatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4547887 |
caagggaacatcgaatactgcttcaacttcggctgaatctaaaattggtgaaaatgtatccttgttggacaatattccaactactggtattattgtgatg |
4547788 |
T |
|
| Q |
118 |
ccatactgcaattaaaataactttgtaagagaactgagttgtgaaatggccaacattggcagtcccactggccagagatcatgcacaagtttaagctata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4547787 |
ccatactgcaattaaaataactttgtaagagaactgagttgtgaaatggccaacattggcagtcccactggccagagatcatgcacaagtttaagctata |
4547688 |
T |
|
| Q |
218 |
taaagatgataggatactagaat |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4547687 |
taaagatgataggatactagaat |
4547665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University