View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3536_low_35 (Length: 240)
Name: NF3536_low_35
Description: NF3536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3536_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 4326730 - 4326537
Alignment:
| Q |
1 |
ctatacaaaaatacattatgttctcgtgcacaatttataaaagtgaagatgattcttatttggtgattgcctaagccctaaacgatgtgt--gtgtatat |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4326730 |
ctatacaaaaatacattatgttctcgtgcacaatttataaaagtgaagatgattcttatttggtgattgcctaagccctaaacgatgtgtgtgtgtatat |
4326631 |
T |
 |
| Q |
99 |
agaggagtggtattcgtatctcttgtatatttggatttggataacacttgttattagtttgttatatcataacttgtgacgcaagttttgcatg |
192 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4326630 |
agaggagtggtattcgtatctcttgtagtattggaattggataacacttgttattagtttgttatatcataacttgtgacgcaagttttgcatg |
4326537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 129 - 163
Target Start/End: Complemental strand, 4330038 - 4330004
Alignment:
| Q |
129 |
ttggatttggataacacttgttattagtttgttat |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4330038 |
ttggatttggataacacttgttattagtttgttat |
4330004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University