View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3536_low_39 (Length: 238)
Name: NF3536_low_39
Description: NF3536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3536_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 47637264 - 47637051
Alignment:
| Q |
16 |
gacatgtacgtaagaagcataacaaagtgcggtaacaacatgaattatagcaatcctactggaagattcgagaatttaccgcgaagttacagcgcggtaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47637264 |
gacatgtacgtaagaagcataacaaagtgcggtaacaacatgaattatagcaatcctactggaagattcgagaatttaccgcgaagttacagcgcggtaa |
47637165 |
T |
|
| Q |
116 |
cttctcgatcaggtggtggcggtgataacgaagattttgctgagttaatgagagcagcttcagctaggactttgggtaaccgaattgatatggatttggt |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47637164 |
cttctcgatcaggtggtggtggtgataacgaagattttgctgagttaatgagagcagcttcagctaggactttgggtaaccgaattgatatggatttggt |
47637065 |
T |
|
| Q |
216 |
tctcaaacaacaac |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47637064 |
tctcaaacaacaac |
47637051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University