View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3536_low_40 (Length: 237)
Name: NF3536_low_40
Description: NF3536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3536_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 20 - 114
Target Start/End: Original strand, 35111960 - 35112054
Alignment:
| Q |
20 |
aaaaacatcatgagacattctcatccaaagatcaaacaattctcagcattgagcatataattgcatcataacaaaatcattttgtgaatgctata |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35111960 |
aaaaatatcatgagacattctcatccaaagatcaaacaattctcagcaatgagcataaaattgcatcatatcaaaatcattttgtgaatgctata |
35112054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 6757419 - 6757207
Alignment:
| Q |
1 |
ttctaaagactaaagaaataaaaacatcatgagacattctcatccaaagatcaaacaattctcagcattgagcatataattgcatcataacaaaatcatt |
100 |
Q |
| |
|
||||||||| || |||| ||||| ||||||||||||| ||||||||| || ||||||||||||||| |||||| || ||||||||| ||||||||| |
|
|
| T |
6757419 |
ttctaaagaacaaggaaagaaaaatatcatgagacattttcatccaaaaattaaacaattctcagcaacgagcatggaagtgcatcatattaaaatcatt |
6757320 |
T |
 |
| Q |
101 |
ttgtgaatgctatagctgatgcacggtgggtca--aa--aggttggagactggtca-tttatgacagaaccggttcgtcagaa-ttcctacttgcaagct |
194 |
Q |
| |
|
||||||||| |||||||| || | | | ||| || ||||||||||||||||| |||||||||||||||||||| | || || ||||||||||||| |
|
|
| T |
6757319 |
ttgtgaatgttatagctgctgtaagttaattcagcaacgaggttggagactggtcattttatgacagaaccggttcgcaataattttctacttgcaagct |
6757220 |
T |
 |
| Q |
195 |
agagcatattcag |
207 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6757219 |
agagcatattcag |
6757207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University