View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3536_low_42 (Length: 233)
Name: NF3536_low_42
Description: NF3536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3536_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 10 - 220
Target Start/End: Complemental strand, 14727565 - 14727355
Alignment:
| Q |
10 |
tcaagaaagaatcaattatgaatttactagaatcttccgccacaaatggtaaaatgaaatacaatagttcagtcaaatcagtccaagaaggatacaaccc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14727565 |
tcaagaaagaatcaattatgaatttactagaatcttccgccacaaatggtaaaatgaaatacaatagttcagtcaaatcagtccaggaaggatacaaccc |
14727466 |
T |
 |
| Q |
110 |
aaatgaaaggtgtgtttaaaggattgcaaaagcagggcagagcttacaatcatttctaatgcaggagactgaactggttttggcaatgcaacttcatgaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14727465 |
aaatgaaaggtgtgtttaaaggattgcaaaagcagggcagagcttacaatcatttctaatgcaggagactgaactggttttggcaatgcaacttcatgaa |
14727366 |
T |
 |
| Q |
210 |
atggaagaaaa |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
14727365 |
atggaagaaaa |
14727355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 137 - 180
Target Start/End: Original strand, 13956509 - 13956552
Alignment:
| Q |
137 |
aaaagcagggcagagcttacaatcatttctaatgcaggagactg |
180 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
13956509 |
aaaagcagggcaaagcttacaatcatttttaatgcaggagactg |
13956552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University