View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3537_high_24 (Length: 361)
Name: NF3537_high_24
Description: NF3537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3537_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 17 - 345
Target Start/End: Original strand, 41067722 - 41068052
Alignment:
| Q |
17 |
ctcaacccttttgtgctagtttctttctaccaccgtgaaaactatttataacaaagatatggttttgaaggaagcaacatctgcaaaggtggtcggtaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41067722 |
ctcaacccttttgtgctagtttctttctaccaccgtgaaaactatttataacaaagatatggttttgaaggaagcaacatctgcaaaggtggtcggaaat |
41067821 |
T |
 |
| Q |
117 |
atttcg-aaaaatctatgtttgagagagacacaaagagacaaaacccgtaggttgttgttgccaatgaaatatgagaaactgaaataacagaaccacgca |
215 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41067822 |
atttcgaaaaaatctatgtttgagagagacacaaagagacaaaacccgtaggttgttgttgccaatgaaatatgagaaactgaaataacagaaccacgca |
41067921 |
T |
 |
| Q |
216 |
cgca-aacannnnnnnnnnnnnnnnnnnnccttattggcgcgaggggaaatgccaatgtcattaacggttaacaccaaattttttacttttacttctccg |
314 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
41067922 |
cgcagaacagtttctttttttgtttttttccttattggcgcgaggggaaatgccaatgtcattaacggttagcaccaaattttttacttttacttcaccg |
41068021 |
T |
 |
| Q |
315 |
gttaaaatgtgcaatattggttacaaattat |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41068022 |
gttaaaatgtgcaatattggttacaaattat |
41068052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University