View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3537_high_41 (Length: 261)
Name: NF3537_high_41
Description: NF3537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3537_high_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 52357617 - 52357857
Alignment:
| Q |
1 |
cctctgtggatccacaatggtaggtggcagtaacaattttgaatggcttcaatactttgatgtggttatcactggcaggtcatgttcttctcttggcagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52357617 |
cctctgtggatccacaatggtaggtggcagtaacaattttgaatggcttcaatactttgatgtggttatcactggcaggtcatgttcttctcttggcagc |
52357716 |
T |
|
| Q |
101 |
gttacccagttatatctgttttctttggcttcattattctgcctaatgtgaattttacccttctggcccttggattcctatgatgcacaaattatgttac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52357717 |
gttacccagttatatctgttttctttggcttcattattctgcctaatatgaattttacccttctggcccttggattcctatgatgcacaaattatgttac |
52357816 |
T |
|
| Q |
201 |
aaacaataaatgggtgctttccaactgttcactttagtcct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52357817 |
aaacaataaatgggtgctttccaactgtttactttagtcct |
52357857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 83
Target Start/End: Complemental strand, 35483901 - 35483853
Alignment:
| Q |
35 |
aattttgaatggcttcaatactttgatgtggttatcactggcaggtcat |
83 |
Q |
| |
|
|||||||| |||||| ||||||||||||| || |||||||||||||||| |
|
|
| T |
35483901 |
aattttgactggcttgaatactttgatgttgtcatcactggcaggtcat |
35483853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 80
Target Start/End: Original strand, 6986301 - 6986356
Alignment:
| Q |
25 |
tggcagtaacaattttgaatggcttcaatactttgatgtggttatcactggcaggt |
80 |
Q |
| |
|
|||||||| |||| | || |||||||||||||||||||| || ||||||||||||| |
|
|
| T |
6986301 |
tggcagtaccaatctggactggcttcaatactttgatgtcgtcatcactggcaggt |
6986356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University