View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3537_high_42 (Length: 259)
Name: NF3537_high_42
Description: NF3537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3537_high_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 49892268 - 49892036
Alignment:
| Q |
18 |
atctttgtctgatggatcaaacaataatggtgatgaaactacttcaactagttcggttattaagagggaatataatattgatgagaattgtgataagggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49892268 |
atctttgtctgatggatcaaacaataatggtgatgaaactacttcaactagttcggttattaagagggaatataatattgatgagaattgtgataagggt |
49892169 |
T |
|
| Q |
118 |
ggtgtaaatagcaatgttgattataaacatagtccttctaatatgatgaagtttgctgatatgccattattcactccaacttcacatgatttctttagct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
49892168 |
ggtgtaaatagcaatgttgattataaacatagtccttctaatatgatgaagtttgctgatatgccattattcactccaacttcacatgatttcttttgct |
49892069 |
T |
|
| Q |
218 |
cctcatcatcacgaccagtgtataaattctctg |
250 |
Q |
| |
|
| ||||||||||||||||||||||||| |||| |
|
|
| T |
49892068 |
ctccatcatcacgaccagtgtataaattttctg |
49892036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 120 - 190
Target Start/End: Original strand, 5527631 - 5527701
Alignment:
| Q |
120 |
tgtaaatagcaatgttgattataaacatagtccttctaatatgatgaagtttgctgatatgccattattca |
190 |
Q |
| |
|
|||||||| |||||||||| ||||||||| || ||||| | ||||||||||||||||||||| |||||||| |
|
|
| T |
5527631 |
tgtaaataacaatgttgatgataaacataatctttctagtctgatgaagtttgctgatatgctattattca |
5527701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University