View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3537_high_59 (Length: 233)
Name: NF3537_high_59
Description: NF3537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3537_high_59 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 40252152 - 40252367
Alignment:
| Q |
18 |
gattgcgcctatttctttccaccagagacacatggatcttgcattacaccaaatcattgtcgttgcttttacaagtctttttattgccaaccagatgaaa |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40252152 |
gattgtgcctatttctttccaccagagacacatggatcttgcattacaccaaatcattgtcgttgcttttacaagtctttttattgccaaccagatgaaa |
40252251 |
T |
|
| Q |
118 |
atgtttgagggcctagcccctccttacc-aaaaattaaataaaagtatactctatttttcaacacttatctttgcttaattgtgttcaatgagttttaat |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40252252 |
atgtttgagggcctagcccc-ccttaccaaaaaattaaataaaagtatactctatttttcaacacttatctttgcttaattgtgttcaatgagttgtaat |
40252350 |
T |
|
| Q |
217 |
ttcttgttgtatttatt |
233 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
40252351 |
ttcttgttatatttatt |
40252367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University