View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3537_high_60 (Length: 232)
Name: NF3537_high_60
Description: NF3537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3537_high_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 94 - 176
Target Start/End: Original strand, 44826596 - 44826678
Alignment:
| Q |
94 |
aaacagagtgttgctgttggagctgtaattatcaccaaaatggatggccatgccaagggtggtggttctcttagcgcgtaagt |
176 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44826596 |
aaacagattgttgctgttggagctgtaattatcaccaaaatggatggccatgccaagggtggtggttctcttagcgcgtaagt |
44826678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 3 - 91
Target Start/End: Original strand, 44826356 - 44826444
Alignment:
| Q |
3 |
tgatcttataattgttgataccagtggacgctacaaacaagaagctgccctatttgaagaaatgcgtcaactttcagaagcaacggtat |
91 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||| |||| |||||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
44826356 |
tgatcttataattgttgataccagtgggcggcacaaacaagaagcatccctttttgaagaaatgcgccaactttcggaagctacggtat |
44826444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 2203757 - 2203665
Alignment:
| Q |
1 |
tgtgatcttataattgttgataccagtggacgctacaaacaagaagctgccctatttgaagaaatgcgtcaactttcagaagcaacggtattt |
93 |
Q |
| |
|
||||||||||||||||||||||| ||||| || |||||||||||||||| || |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2203757 |
tgtgatcttataattgttgatactagtgggcggcacaaacaagaagctgctctttttgaagaaatgcgtcaagtttcagaagcaacggtattt |
2203665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 90 - 176
Target Start/End: Complemental strand, 2203519 - 2203433
Alignment:
| Q |
90 |
atttaaacagagtgttgctgttggagctgtaattatcaccaaaatggatggccatgccaagggtggtggttctcttagcgcgtaagt |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| |||||||||||| | ||||| |||||||| |
|
|
| T |
2203519 |
atttaaacagagtgttgcagttggagctgtcattatcacaaaaatggatggccatgcaaagggtggtggtgcacttagtgcgtaagt |
2203433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 90 - 176
Target Start/End: Complemental strand, 33115776 - 33115690
Alignment:
| Q |
90 |
atttaaacagagtgttgctgttggagctgtaattatcaccaaaatggatggccatgccaagggtggtggttctcttagcgcgtaagt |
176 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| | | |||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
33115776 |
atttacacagagtgttgacattggagctgtaattgtttctaaaatggatggctatgccatgggtggtggttctcttagcgcgtaagt |
33115690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University