View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3537_high_63 (Length: 218)
Name: NF3537_high_63
Description: NF3537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3537_high_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 6980818 - 6981020
Alignment:
| Q |
1 |
cattccaatcccaacctctcattgttcttgccgtgggcgttatttaaacatctctttgcataatgagaaattcaaaccgtttcatttcgtttctttctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6980818 |
cattccaatcccaacctctcattgttctcgccgtgggcgttatttaaacctctctttgcataatgagaaattcaaaccgtttcatttcgtttctttctct |
6980917 |
T |
 |
| Q |
101 |
ctccgtaaccgtttctctcttcgtcattgctttgcttctagaatcttctccgatgctcactctccgccgcgctttctcccctttccgccgccgccgtcgt |
200 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6980918 |
ctccgtaaccgtttctctccttgtcattgctttgcttctagaatcttctccgatgctcactctccgccgcgctttctcccctttccgccgccgccgtcgt |
6981017 |
T |
 |
| Q |
201 |
ctc |
203 |
Q |
| |
|
||| |
|
|
| T |
6981018 |
ctc |
6981020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 74 - 120
Target Start/End: Complemental strand, 35487941 - 35487895
Alignment:
| Q |
74 |
aaaccgtttcatttcgtttctttctctctccgtaaccgtttctctct |
120 |
Q |
| |
|
|||||| |||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
35487941 |
aaaccgcttcatttcatttctttctctctccataaccgtttttctct |
35487895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University