View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3537_low_33 (Length: 330)
Name: NF3537_low_33
Description: NF3537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3537_low_33 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 330
Target Start/End: Original strand, 25897604 - 25897936
Alignment:
| Q |
1 |
tgttgttgttatgttattatattatccattagaatcttctctcattggcagtggtgcaatcctttgctatgtgtggatatcatatcatgaccctgcccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25897604 |
tgttgttgttatgttattatattatccattagaatcttctctcattggcagtggtgcaatcctttgctatgtgtggatatcatatcatgaccctgcccca |
25897703 |
T |
 |
| Q |
101 |
catcacactgcaccagtgatcagtcctcaacatttgtgggttatataagattggttagcattcaagggtgttcaacaaatgttggtttataaatattaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25897704 |
catcacactgcaccagtgatcagtcctcaacatttgtgggttatataagattggtcagcattcaagggtgttcaacaaatgttggtttataaatattaaa |
25897803 |
T |
 |
| Q |
201 |
gacttgtataaaattcatcgga---nnnnnnnnnctttcattcttttcacacctagaatgtgaccgaaaaaacattttaactaatagtatgaatttggtc |
297 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25897804 |
gacttgtataaaattcatcggattttttttttttttttcattcttttcacacctagaatgtgaccgaaaaaacattttaactaatagtatgaatttggtc |
25897903 |
T |
 |
| Q |
298 |
gaaaaataagtaaaatttaactaaaattggtca |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25897904 |
gaaaaataagtaaaatttaactaaaattggtca |
25897936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University