View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3537_low_49 (Length: 254)
Name: NF3537_low_49
Description: NF3537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3537_low_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 177 - 240
Target Start/End: Complemental strand, 33167278 - 33167215
Alignment:
| Q |
177 |
ggtacattggtcttattaatgttatatgtgcagtgttgcagcaacaaagagtcgtgtcatattc |
240 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33167278 |
ggtacattggtcttattaatgctatgtgtgcagtgttgcagcaacaaagagtcctgtcatattc |
33167215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 182 - 228
Target Start/End: Complemental strand, 33115556 - 33115510
Alignment:
| Q |
182 |
attggtcttattaatgttatatgtgcagtgttgcagcaacaaagagt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33115556 |
attggtcttattaatgttatatgtgcagtgttgcagcaacaaagagt |
33115510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 170 - 240
Target Start/End: Original strand, 44827137 - 44827204
Alignment:
| Q |
170 |
tgctttgggtacattggtcttattaatgttatatgtgcagtgttgcagcaacaaagagtcgtgtcatattc |
240 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44827137 |
tgctttgggtacatt---cttattaattttatatgtgcagtgttgcagcaacaaagagtcctgtcatattc |
44827204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University