View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3537_low_53 (Length: 250)
Name: NF3537_low_53
Description: NF3537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3537_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 53185571 - 53185330
Alignment:
| Q |
1 |
ataaatcttaatcatgatgtggctgtacctaaacatctaagcggttgagaactcaattgataatagtcgtaagagaaacctttaactttattcttaatct |
100 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
53185571 |
ataaatcttaatcatgatgtggttgcacctaaacatctaaacagttgagaactcaattgataatagtcgtaagagaaacccttaactttgttcttaatca |
53185472 |
T |
|
| Q |
101 |
aagaccnnnnnnnnnnnnnnnnnttaccatatcaaaaatagagacattagagcaatcatgtaggtgaaaaatattatgattccgctgcttccatattgac |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
53185471 |
aagaccaaaaggaaaaaaaaa--ttaccatatcaaaaatagagacattagagcaatcatgtaggtcaaaaatattatgattacgctgcttccatattgac |
53185374 |
T |
|
| Q |
201 |
cataaacatgcctaccatgttactt-aaagatatccctttgctt |
243 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
53185373 |
cataaacatgcctaccatgttacttaaaagatatccctatgctt |
53185330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University