View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3537_low_57 (Length: 245)
Name: NF3537_low_57
Description: NF3537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3537_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 3 - 228
Target Start/End: Original strand, 32102554 - 32102779
Alignment:
| Q |
3 |
aggaggagcagagaaagagacacacatcaaatagaaccattcagattctgttaggtcctcaggtgacaaggaagcacatggacgacgagttggtggatta |
102 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32102554 |
aggaggaaaagagaaagagacacacatcaaatagaaccattcagattctgttaggtcctcaggtgacaaggaagcacatggacgacgagttggtggattt |
32102653 |
T |
 |
| Q |
103 |
gtctctccggcagacaatgattcatagagttctcttagttgctggcttctttgtagagatgcttcctcagcactaacctccattggttgcactgtctttc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32102654 |
gtctctccggcagacaatgattcatagagttctcttagttgctggcttctttgtagagatgcttcctcagcactaacctccattggttgcactgtctttc |
32102753 |
T |
 |
| Q |
203 |
gagtcttaattgatccattgtaatat |
228 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32102754 |
gagtcttaattgatccattgtaatat |
32102779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University