View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3538_high_25 (Length: 298)
Name: NF3538_high_25
Description: NF3538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3538_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 40777599 - 40777877
Alignment:
| Q |
1 |
gttgcaggtttatgcagataactaacttggtctattggagaaagactcgctaaagcaaactgaaaaccgatcgagattgaagagtgtcgtagtaatttgg |
100 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40777599 |
gttggaggtttatgcagataac----ttggtctattggagaaagactcgctaaagcaaactgaaaaccgatcgagattgaagagtgtcgtagtaatttgg |
40777694 |
T |
|
| Q |
101 |
ttcgacgttgtgaccaaggcggatgcacaaatcttcttagtttcattctcttaaaacccattggtatatctatatctcttaatat--nnnnnnnnnnnnn |
198 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40777695 |
ttcgatgttgtgaccaaggcggatgcacaaatcttcttagtttcattctcttaaaacccattggtatatctatatctcttaatataaaaataaaaaaaat |
40777794 |
T |
|
| Q |
199 |
nnnnnnntcatgcttcagccaagtcaatgaagaaggtgaactatatctcttatttggaagactttggtggtgtgcgggtaact |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40777795 |
ataaaaatcatgcttcagccaagtcaatgaagaaggtgaactatatctcttatttggaagactttggtggtgtgcgggtaact |
40777877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University