View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3538_high_29 (Length: 256)
Name: NF3538_high_29
Description: NF3538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3538_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 217
Target Start/End: Complemental strand, 6411833 - 6411635
Alignment:
| Q |
19 |
tgaacttagtaactggtttttgtaacctacgaatatgtacaaaaccaggtttaaaatatccagttttacatacttcttgtttcttatttgccacccatct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6411833 |
tgaacttagtaactggtttttgtaacctacgaatatgtacaaaaccaggtttaaaatatccagttttacatacttcttgtttcttatttgccacccatct |
6411734 |
T |
 |
| Q |
119 |
taaaaaattacagacttcggcaaattattttgatcagttcactgaatcgtgctgttcaaatttaagcccatagcctattatatattgatattgagctta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6411733 |
taaaaaattacagacttcggcaaattattttgatcagttcactgaatcgtgctgttcaaatttaagcccatagcctattatatattgatattgagctta |
6411635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 126
Target Start/End: Complemental strand, 6409081 - 6408968
Alignment:
| Q |
19 |
tgaacttagtaactggtttttgtaacctacgaatatgtacaaaaccaggtttaaaatatccagtttta------catacttcttgtttcttatttgccac |
112 |
Q |
| |
|
|||||||||||| || || |||||| |||| ||| |||||||||||||||||||||| || ||||||| || ||||||||||||||||| |||| |
|
|
| T |
6409081 |
tgaacttagtaattgattgttgtaaactactaatttgtacaaaaccaggtttaaaatttcaagttttaacactgcaaacttcttgtttcttattcgccat |
6408982 |
T |
 |
| Q |
113 |
ccatcttaaaaaat |
126 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
6408981 |
tcatcttaacaaat |
6408968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 170 - 210
Target Start/End: Complemental strand, 6408529 - 6408489
Alignment:
| Q |
170 |
ctgttcaaatttaagcccatagcctattatatattgatatt |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
6408529 |
ctgttccaatttaagcccatagcctattatatatcgatatt |
6408489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University