View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3538_high_48 (Length: 215)
Name: NF3538_high_48
Description: NF3538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3538_high_48 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 21155301 - 21155515
Alignment:
| Q |
1 |
tatttttcttcttttcttcaccttggatgcattgcacgaccttgttgtctttaaccttgaatctcaacaacaaactctttttacggttattatcattatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21155301 |
tatttttcttcttttcttcaccttggatgcattgcacgaccttgttgtctttaaccttgaatctcaacaacaaactctttttacggttattatcattatt |
21155400 |
T |
|
| Q |
101 |
atccttcttcaccttagtagccggtgtttcatcgatgtcactaacttgtttctcgatcttgtcattatccacattgcttgaagctttgagcttttcatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21155401 |
atccttcttcaccttagtagccggtgtttcatcgatgtcactaacttgtttctcgatcttgtcattatccacattgcttgaagctttgagcttttcatgt |
21155500 |
T |
|
| Q |
201 |
agatgaccataatca |
215 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
21155501 |
agatgaccatgatca |
21155515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 30 - 215
Target Start/End: Original strand, 3073522 - 3073704
Alignment:
| Q |
30 |
cattgcacgaccttgttgtctttaaccttgaatctcaacaacaaactctttttacggttattatcattattatccttcttcaccttagtagccggtgttt |
129 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||| |||| ||||||| |||||| |||||| | |||||||| || |||| ||||| |
|
|
| T |
3073522 |
cattgcacgaccttgttgtcttttaccttgaatctaaacaaaaaacaatttttacaactattattgttattaa---tattcaccttggtcgccgatgttt |
3073618 |
T |
|
| Q |
130 |
catcgatgtcactaacttgtttctcgatcttgtcattatccacattgcttgaagctttgagcttttcatgtagatgaccataatca |
215 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||| |||||| ||||||| |||| |
|
|
| T |
3073619 |
catcaatgtcactaacttgtttctcgatcttgtcattatccacaattgttgaagctttgaactttttatgtaggtgaccatgatca |
3073704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 21249660 - 21249466
Alignment:
| Q |
1 |
tatttttcttcttttcttcaccttggatgcattgcacgaccttgttgtctttaaccttgaatctcaacaacaaactctttttacggttattatcattatt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||| || || | |||||||||||||| ||||||||| |
|
|
| T |
21249660 |
tatttttcttcttttcttcatcttggctgcattgccagaccttgttgtctttaatcttggatagcat-agcaaactctttttactgttattatc------ |
21249568 |
T |
|
| Q |
101 |
atccttcttcaccttagtagccggtgtttcatcgatgtcactaacttgtttctcgatcttgtcattatccacattgcttgaagctttgagcttttcatgt |
200 |
Q |
| |
|
||||||||| || ||| |||| ||| ||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21249567 |
------cttcaccttggttgccaatgttacattaatgtcaccaacttgtttctcgatcttttcattatccacattgcttgaagctttgagctttttatgt |
21249474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 27731892 - 27731998
Alignment:
| Q |
1 |
tatttttcttcttttcttcaccttggatgcattgcacgaccttgttgtctttaaccttgaatctcaacaacaaactctttttacggttattatcattatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||| | |||||||||||||| |||||||| |||||| |
|
|
| T |
27731892 |
tatttttcttcttttcttcaccttggatgcattgccagaccttgttgtctttaatcttgaatatcagccgcaaactctttttactgttattattattatt |
27731991 |
T |
|
| Q |
101 |
atccttc |
107 |
Q |
| |
|
|||||| |
|
|
| T |
27731992 |
ctccttc |
27731998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 155 - 215
Target Start/End: Original strand, 27732004 - 27732064
Alignment:
| Q |
155 |
gatcttgtcattatccacattgcttgaagctttgagcttttcatgtagatgaccataatca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||| ||||| ||||||| |||| |
|
|
| T |
27732004 |
gatcttgtcattatccacattgcttgaaactttgaactttttatgtacctgaccatgatca |
27732064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University