View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3538_high_49 (Length: 205)
Name: NF3538_high_49
Description: NF3538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3538_high_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 25 - 189
Target Start/End: Original strand, 48040800 - 48040964
Alignment:
| Q |
25 |
gataggaataggaacaatcacattaaagagaggacgttgggctaggaagctagcaccaattgtaaataagatggttaaatcccgacttagctggtttgga |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48040800 |
gataggaataggaacaatcacattaaagagaggacgttgggctagcaagctagcaccaattgtaaataagatggttaaatcccgacttagctggtttgga |
48040899 |
T |
|
| Q |
125 |
catgtgtggaggaaatctattatagtaaggagaatagatcacatggatggtggttcagtcgattg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48040900 |
catgtgtggaggaaatctattatagtaaggagaatagatcacatggatggtggttcagtcgattg |
48040964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 25 - 187
Target Start/End: Original strand, 48049093 - 48049260
Alignment:
| Q |
25 |
gataggaataggaacaatcacattaaagagaggacgttgggctaggaagctagcaccaattgtaaataagatggttaaatcccgacttagctggtttgga |
124 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48049093 |
gataggaataggaacaataacattaaagagagggagttgggctagcaagctagcaccaattgt-aataagatggttaaatctcgacttagctggtttgga |
48049191 |
T |
|
| Q |
125 |
catgtgtggaggaaatctat------tatagtaaggagaatagatcacatggatggtggttcagtcgat |
187 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
48049192 |
catgtgtgaaggaaatctatagattctatagtaagaagaatagatcacatatgtggtggatcagtcgat |
48049260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 75 - 144
Target Start/End: Complemental strand, 29813192 - 29813123
Alignment:
| Q |
75 |
tagcaccaattgtaaataagatggttaaatcccgacttagctggtttggacatgtgtggaggaaatctat |
144 |
Q |
| |
|
||||||| |||||| ||| |||| ||||||| || |||| ||||||||||||||||||||||||||||| |
|
|
| T |
29813192 |
tagcacctattgtatatacgatgcttaaatctagatttaggtggtttggacatgtgtggaggaaatctat |
29813123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 114 - 144
Target Start/End: Original strand, 48035317 - 48035347
Alignment:
| Q |
114 |
gctggtttggacatgtgtggaggaaatctat |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48035317 |
gctggtttggacatgtgtggaggaaatctat |
48035347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University