View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3538_low_20 (Length: 327)
Name: NF3538_low_20
Description: NF3538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3538_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 16 - 314
Target Start/End: Complemental strand, 40621456 - 40621158
Alignment:
| Q |
16 |
attgcatgtaaaaccactacctcaattgaagcctaaaaaacttttaatcatagtaacaccaacaagcacaaaactaccttatcacaatgnnnnnnngaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40621456 |
attgcatgtaaaaccactacctcaattgaagcctaaaagacttttaatcatagtaacaccaacaagcacaaaactaccttatcacaatgtttttttgaga |
40621357 |
T |
 |
| Q |
116 |
aggttggcaaatactataaagcttgttgttcaaccattgctttggattgttgtcgaagcgaaaaccgaatcaactgaattgccagagatattgaggaaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40621356 |
aggttggcaaatactataaagcttgttgatcaaccattgctttggattgttgtcgaagcgaaaaccgaatcaactgaattgccagagatattgaggaaaa |
40621257 |
T |
 |
| Q |
216 |
ctggtatcatgtatagacatgttgttttcagtgaagagttcatggacttagaagctgaattgaatcatcaaagaaatttagctcttagacacattgaac |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40621256 |
ctggtatcatgtatagacatgttgttttcagtgaagagttcatggacttagaagctgaattgaatcatcaaagaaatttagctcttagacacattgaac |
40621158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University