View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3538_low_32 (Length: 250)
Name: NF3538_low_32
Description: NF3538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3538_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 141 - 238
Target Start/End: Complemental strand, 24949269 - 24949169
Alignment:
| Q |
141 |
aacttacgtattat---acgtatattatttctttatccccataaaaaatagtagttccatatcacatttgaattctaataatattaattgactcttcttc |
237 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24949269 |
aacttacgtattattctacgtatattatttctttatccccataaaaaatagtagttccatatcacatttgaattctaataatattaattgactcttcttc |
24949170 |
T |
 |
| Q |
238 |
t |
238 |
Q |
| |
|
| |
|
|
| T |
24949169 |
t |
24949169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 24949411 - 24949345
Alignment:
| Q |
1 |
ctgatctgatcagtggatcatcggtcagatcacatgattattgacctagacattgatgagaaattct |
67 |
Q |
| |
|
||||||| |||||||||||||||||| |||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
24949411 |
ctgatctaatcagtggatcatcggtcggatcccatgactattgaccgagacattgatgagaaattct |
24949345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University