View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3538_low_36 (Length: 242)
Name: NF3538_low_36
Description: NF3538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3538_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 42816806 - 42816579
Alignment:
| Q |
1 |
aatcttgacatatgttcaagaaagaaattgcaaaggcaacgaataaactatcttggacctgtaaattttttcattcacccacattgcattcaataactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42816806 |
aatcttgacatatgttcaagaaagaaattgcaaatgcaacgaataaactatcttggacctgtaaattttttcattcacccacattgcattcaataactct |
42816707 |
T |
|
| Q |
101 |
agttaatatgagcatttcagactatcaaactattttataattttcaaagtttgccactaaatttttatgttgtattaataacttcaacattgatgcttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42816706 |
agttaatatgagcatttcagactatcaaactattttataattttcaaagtttgccactaaatttttatgttgtattaacaacttcaacattgatgcttgc |
42816607 |
T |
|
| Q |
201 |
aattttcagatagagagggaagcatatg |
228 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
42816606 |
aatttgcagatagagagggaagcatatg |
42816579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University