View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3538_low_37 (Length: 239)
Name: NF3538_low_37
Description: NF3538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3538_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 1516228 - 1516456
Alignment:
| Q |
1 |
ttgtgtgtttatgtcatattacttgcttgcaaatagtggaatattaaattatattttttcgattacgtttcctggcaggatttgatgcttggtgttgccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1516228 |
ttgtgtgtttatgtcatattacttgcttgcaaatagtggaatattaaattatattttttcgattacgtttcctggcaggatttgatgcttggtgttgccg |
1516327 |
T |
 |
| Q |
101 |
atcttaatacacctgaggctgttgctgctgcagagtcagctatttccaattctcagcctgtgatttcattggctgctgacgatgatagtgaaacagattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1516328 |
atcttaatacacctgaggctgttgctgctgcagagtcagctatttccaattctcagcctgtgatttcattggctgctgacgatgatagtgaaacagattc |
1516427 |
T |
 |
| Q |
201 |
agaagaagaaagtagcactgatgatgatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1516428 |
agaagaagaaagtagcactgatgatgatg |
1516456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 72 - 226
Target Start/End: Complemental strand, 36613686 - 36613535
Alignment:
| Q |
72 |
ctggcaggatttgatgcttggtgttgccgatcttaatacacctgaggctgttgctgctgcagagtcagctatttccaattctcagcctgtgatttcattg |
171 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||| |||||||| || ||||||||||||||| |||||| || ||||||||||||||||||| |
|
|
| T |
36613686 |
ctggcaggatttgatgcttggtgttgctgatcttcatacaccagaggctgtggcagctgcagagtcagctgtttccagttgtcagcctgtgatttcattg |
36613587 |
T |
 |
| Q |
172 |
gctgctgacgatgatagtgaaacagattcagaagaagaaagtagcactgatgatg |
226 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||| || | ||||||| |
|
|
| T |
36613586 |
gctgct---gatgatagtgaaatagattcagaagaagaaagtggcgccgatgatg |
36613535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University