View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3538_low_41 (Length: 234)
Name: NF3538_low_41
Description: NF3538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3538_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 50049092 - 50048871
Alignment:
| Q |
1 |
cataatcctgacattctttgtggcttacttggataaatcaacttatttccttgttgatgaccataagaagattgctatcaggtgcgtatatgccatactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50049092 |
cataatcctgacattctttgtggcttacttggataaatcaacttatttccttgttgatgaccataagaagattgctatcaggtgcgtatatgccatactt |
50048993 |
T |
 |
| Q |
101 |
tccacatccacacagc-nnnnnnnnntgacaacccaactaggtgccgcaaggtattgactgcggcttagaccctttaggatcgccgagactaatcattga |
199 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50048992 |
tccacatccacacagcaaaaaaaaaatgacaacccaactaggtgccgcaaggtattgactatagcttagaccctttgggatcgccgagactaatcattga |
50048893 |
T |
 |
| Q |
200 |
ctctgcaatggggcattcatttt |
222 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
50048892 |
ctctgcaat-gggcattcatttt |
50048871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University