View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3538_low_42 (Length: 233)
Name: NF3538_low_42
Description: NF3538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3538_low_42 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0268 (1 HSPs) |
 |  |  |
|
| [»] scaffold1613 (1 HSPs) |
 |  |  |
|
| [»] scaffold0293 (1 HSPs) |
 |  |  |
|
| [»] scaffold0097 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 2486369 - 2486156
Alignment:
| Q |
1 |
tgtggctatgtgagcatttctaattcaaaagcaacaaatacgtacataaataatttttgttgtgttgtgtttaatggtatatcaatattattccatctcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2486369 |
tgtggctatgtgagcatttctaattcaaaagcaacaaatac----ataaataatttttgttgtgttgtgtttaatggtatatcaatattattccatctcg |
2486274 |
T |
 |
| Q |
101 |
ttataaagatttagcatatatcttcctttatagtgtaaaaattgttcctcttttttgaactagcgaaaagatcggtac-tcaagtgtccgtctttccgct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||| || |||||| |||| |
|
|
| T |
2486273 |
ttataaagatttagcatatatcttcctttatagtgtaaaaattgttcctcttttttgaactagcgaaaagacggacacttcacgt----gtcttttcgct |
2486178 |
T |
 |
| Q |
200 |
ctttttattatgttaaagtttg |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2486177 |
ctttttattatgttaaagtttg |
2486156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 32531390 - 32531341
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
|||||||||||||| || ||||||| | ||||||||||||||||||||| |
|
|
| T |
32531390 |
actagcgaaaagatgggaactcaagcattcgtctttccgctctttttatt |
32531341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 27088955 - 27088742
Alignment:
| Q |
1 |
tgtggctatgtgagcatttctaattcaaaagcaacaaatacgtacataaataatttttgttgtgttgtgtttaatggtatatcaatattattccatctcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27088955 |
tgtggctatgtgagcatttctaattcaaaagcaacaaatac----ataaataatttttgttgtgttgtgtttaatggtatatcaatattattccatctcg |
27088860 |
T |
 |
| Q |
101 |
ttataaagatttagcatatatcttcctttatagtgtaaaaattgttcctcttttttgaactagcgaaaagatcggtac-tcaagtgtccgtctttccgct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||| || |||||| |||| |
|
|
| T |
27088859 |
ttataaagatttagcatatatcttcctttatagtgtaaaaattgttcctcttttttgaactagcgaaaagacggacacttcacgt----gtcttttcgct |
27088764 |
T |
 |
| Q |
200 |
ctttttattatgttaaagtttg |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
27088763 |
ctttttattatgttaaagtttg |
27088742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 161 - 220
Target Start/End: Original strand, 32006335 - 32006393
Alignment:
| Q |
161 |
tagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaaagttt |
220 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
32006335 |
tagcgaaaaga-cggtactcatgtgtccgtctttccactctttttattgggttaaagttt |
32006393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 221
Target Start/End: Complemental strand, 35519345 - 35519282
Alignment:
| Q |
158 |
aactagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
|||||||||||||| || ||||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
35519345 |
aactagcgaaaagacgggcactcacatgtccgtctttccgctctttttattgtgttaacgtttg |
35519282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 1183927 - 1183977
Alignment:
| Q |
158 |
aactagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
||||||||||||||| || ||||| ||| ||||||||||||||||||||| |
|
|
| T |
1183927 |
aactagcgaaaagataggcactcacgtgctcgtctttccgctctttttatt |
1183977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 38740585 - 38740634
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||||| |||||||||||| |
|
|
| T |
38740585 |
actagcgaaaaattgggtactcatgtgtccgtctttcggctctttttatt |
38740634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 209
Target Start/End: Complemental strand, 51610356 - 51610328
Alignment:
| Q |
181 |
aagtgtccgtctttccgctctttttatta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51610356 |
aagtgtccgtctttccgctctttttatta |
51610328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 9)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 158 - 221
Target Start/End: Complemental strand, 13469437 - 13469374
Alignment:
| Q |
158 |
aactagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
|||| ||||||||| || ||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13469437 |
aacttgcgaaaagacgggcactcacgtgcccgtctttccgctctttttattatgttaaagtttg |
13469374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 221
Target Start/End: Complemental strand, 13150220 - 13150157
Alignment:
| Q |
158 |
aactagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
|||||| |||||||| | |||||| |||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
13150220 |
aactagtgaaaagatggatactcacgtgtccgtctttccgctctttttattgcgttaacgtttg |
13150157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 1372864 - 1372815
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||||| |||||||||||| |
|
|
| T |
1372864 |
actagcgaaaagttgggtactcacgtgtccgtctttcggctctttttatt |
1372815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 206
Target Start/End: Original strand, 10864991 - 10865043
Alignment:
| Q |
154 |
tttgaactagcgaaaagatcggtactcaagtgtccgtctttccgctcttttta |
206 |
Q |
| |
|
|||| ||||||||||||| ||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
10864991 |
tttggactagcgaaaagaccggcactcatgtgcccgtctttccgctcttttta |
10865043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 220
Target Start/End: Complemental strand, 16326935 - 16326872
Alignment:
| Q |
157 |
gaactagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaaagttt |
220 |
Q |
| |
|
|||||||||||||||| || |||| ||| ||||||||| |||||||||||| || |||||||| |
|
|
| T |
16326935 |
gaactagcgaaaagatgggcgctcacgtgcccgtctttctgctctttttattgtgataaagttt |
16326872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 1759441 - 1759490
Alignment:
| Q |
159 |
actagcgaaaagatcggt-actcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
1759441 |
actagcgaaaaga-cggtcactcaagtgtccgtctctccgctctttttatt |
1759490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 205
Target Start/End: Complemental strand, 15899039 - 15898993
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctcttttt |
205 |
Q |
| |
|
||||||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
15899039 |
actagcgaaaagacgggcactcacgtgtccgtctttccgctcttttt |
15898993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 205
Target Start/End: Original strand, 30800403 - 30800449
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctcttttt |
205 |
Q |
| |
|
|||||||||||||| || ||||| ||||||||||||| ||||||||| |
|
|
| T |
30800403 |
actagcgaaaagatagggactcacgtgtccgtctttctgctcttttt |
30800449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 9503255 - 9503206
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
||||||||||||| || |||| ||||||||||||||| ||||||||||| |
|
|
| T |
9503255 |
actagcgaaaagacgggcactcgagtgtccgtctttcctctctttttatt |
9503206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 35379637 - 35379588
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
|||||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
35379637 |
actagcgaaaagatgggtacccacgtgtccgtctttccgctctttttatt |
35379588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 158 - 208
Target Start/End: Complemental strand, 5530885 - 5530835
Alignment:
| Q |
158 |
aactagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||||||||| |||||||||||| |
|
|
| T |
5530885 |
aactagcgaaaagatcggcactcacgtgcccgtctttctgctctttttatt |
5530835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 31766460 - 31766509
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||||| |||||||||||| |
|
|
| T |
31766460 |
actagcgaaaagttgggtactcacgtgtccgtctttcggctctttttatt |
31766509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 221
Target Start/End: Original strand, 42857372 - 42857428
Alignment:
| Q |
165 |
gaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
||||||| |||||||| ||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
42857372 |
gaaaagacgggtactcacgtgcccatcttttcgctctttttattatgttaaagtttg |
42857428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 14266064 - 14266015
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
|||||| |||||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
14266064 |
actagcaaaaagaagggcactcacgtgtccgtctttccgctctttttatt |
14266015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 158 - 215
Target Start/End: Original strand, 14771074 - 14771130
Alignment:
| Q |
158 |
aactagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaa |
215 |
Q |
| |
|
|||||||||||||| ||| ||||| || |||||||||||||||||||||| |||||| |
|
|
| T |
14771074 |
aactagcgaaaaga-cggcactcacgtacccgtctttccgctctttttattgtgttaa |
14771130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 54768215 - 54768166
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
|||||||||||||| || ||||| ||||| |||||| ||||||||||||| |
|
|
| T |
54768215 |
actagcgaaaagatgggcactcacgtgtctgtcttttcgctctttttatt |
54768166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 21091777 - 21091825
Alignment:
| Q |
160 |
ctagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
||||||||||||| | ||||| |||||||||||||| ||||||||||| |
|
|
| T |
21091777 |
ctagcgaaaagatggacactcacgtgtccgtctttcctctctttttatt |
21091825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 46530520 - 46530468
Alignment:
| Q |
163 |
gcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaa |
215 |
Q |
| |
|
|||||||||| || ||||| ||| || |||||||||||||||||||| ||||| |
|
|
| T |
46530520 |
gcgaaaagattggcactcatgtgcccatctttccgctctttttattacgttaa |
46530468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 221
Target Start/End: Complemental strand, 44648508 - 44648445
Alignment:
| Q |
158 |
aactagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
||||||||||||||| || ||||| ||||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
44648508 |
aactagcgaaaagataggcactcacatgtccgtctttccgctctttttattgtgctaacgtttg |
44648445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 159 - 221
Target Start/End: Original strand, 38619431 - 38619493
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
|||||||||||||| || | ||| |||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
38619431 |
actagcgaaaagatgggcattcacgtgtccgtctttccgctctttttattgcgttaaggtttg |
38619493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 221
Target Start/End: Original strand, 1580999 - 1581061
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
||||||||||||| | ||||| |||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
1580999 |
actagcgaaaagacggacactcaggtgtccgtctttccgctctttttattgcgctaaagtttg |
1581061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 4242315 - 4242277
Alignment:
| Q |
183 |
gtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
4242315 |
gtgtccgtctttccgctctttttattatgctaacgtttg |
4242277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 38544073 - 38544123
Alignment:
| Q |
158 |
aactagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
||||||| |||||| || ||||||||||||||||||||| |||||||||| |
|
|
| T |
38544073 |
aactagcaaaaagaggggcactcaagtgtccgtctttccgatctttttatt |
38544123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 220
Target Start/End: Complemental strand, 31845357 - 31845313
Alignment:
| Q |
176 |
tactcaagtgtccgtctttccgctctttttattatgttaaagttt |
220 |
Q |
| |
|
|||||| ||| |||| |||||| |||||||||||||||||||||| |
|
|
| T |
31845357 |
tactcacgtgcccgtttttccgatctttttattatgttaaagttt |
31845313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 13450425 - 13450376
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
13450425 |
actagcgaaaagacgggtactcacgtgcccgtctttccgctctttttatt |
13450376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 20718300 - 20718259
Alignment:
| Q |
163 |
gcgaaaagatcggtactcaagtgtccgtctttccgctctttt |
204 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
20718300 |
gcgaaaagatcggcactcacgtgcccgtctttccgctctttt |
20718259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 21885130 - 21885179
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
|||||||||||||| || ||||| ||| ||||||||| |||||||||||| |
|
|
| T |
21885130 |
actagcgaaaagatgggcactcacgtgcccgtctttctgctctttttatt |
21885179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 221
Target Start/End: Original strand, 3357172 - 3357216
Alignment:
| Q |
177 |
actcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
||||| ||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
3357172 |
actcatgtgcccgtctttctgttctttttattatgttaaagtttg |
3357216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 215
Target Start/End: Complemental strand, 227533 - 227477
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaa |
215 |
Q |
| |
|
||||||||||||| | ||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
227533 |
actagcgaaaagacgagcactcacgtgtccgtctttccgctctttttattgtgttaa |
227477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 221
Target Start/End: Complemental strand, 19930517 - 19930473
Alignment:
| Q |
177 |
actcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
19930517 |
actcacgtgtccatctttccgctctttttattatgttaacgtttg |
19930473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 221
Target Start/End: Complemental strand, 23270911 - 23270864
Alignment:
| Q |
174 |
ggtactcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
23270911 |
ggtactcacgtgcccgtctttccgctctttttattgcgttaaagtttg |
23270864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 208
Target Start/End: Complemental strand, 28766560 - 28766513
Alignment:
| Q |
161 |
tagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
|||||||||||| || ||||| ||| |||||||||||||||||||||| |
|
|
| T |
28766560 |
tagcgaaaagatgggcactcatgtgcccgtctttccgctctttttatt |
28766513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 221
Target Start/End: Complemental strand, 3295878 - 3295817
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
||||||||||||| |||||||| ||||| |||||||||||||||||||| || ||| ||||| |
|
|
| T |
3295878 |
actagcgaaaagacgggtactcacgtgtc-gtctttccgctctttttattgtgctaacgtttg |
3295817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Original strand, 16610544 - 16610582
Alignment:
| Q |
177 |
actcaagtgtccgtctttccgctctttttattatgttaa |
215 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
16610544 |
actcacgtgtccgtctttccgctctttttattacgttaa |
16610582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 221
Target Start/End: Complemental strand, 33629630 - 33629568
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
|||||| |||||| || |||||||||||||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
33629630 |
actagcaaaaagaagggcactcaagtgtccgtctttccactctttttattgcgttaatgtttg |
33629568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 215
Target Start/End: Original strand, 8942630 - 8942662
Alignment:
| Q |
183 |
gtgtccgtctttccgctctttttattatgttaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
8942630 |
gtgtccgtctttccgctctttttattacgttaa |
8942662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0268 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0268
Description:
Target: scaffold0268; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 221
Target Start/End: Complemental strand, 21482 - 21419
Alignment:
| Q |
158 |
aactagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
||||||| ||||||| || |||| |||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
21482 |
aactagcaaaaagatgggcactcgcgtgtccgtctttccgctctttttattgcgctaaagtttg |
21419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 221
Target Start/End: Original strand, 15566577 - 15566640
Alignment:
| Q |
158 |
aactagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
||||||||||||| || ||||| ||| | |||||||||||| |||||||||||||||||||| |
|
|
| T |
15566577 |
aactagcgaaaagtcgggcactcacgtgcctgtctttccgctcattttattatgttaaagtttg |
15566640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 221
Target Start/End: Original strand, 21080021 - 21080083
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
|||||||||||||| || ||| | ||||||||||||| |||||||||||| | ||||||||| |
|
|
| T |
21080021 |
actagcgaaaagatgggcacttacgtgtccgtctttctactctttttattacgctaaagtttg |
21080083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 3996598 - 3996647
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
||||||||||||| | ||||| |||||||||||||||||||||||||| |
|
|
| T |
3996598 |
actagcgaaaagacgagcactcacgtgtccgtctttccgctctttttatt |
3996647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 5800521 - 5800472
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
||||||||||||| | ||||| |||||||||||||||||||||||||| |
|
|
| T |
5800521 |
actagcgaaaagacggacactcacgtgtccgtctttccgctctttttatt |
5800472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 204
Target Start/End: Complemental strand, 9060199 - 9060154
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttt |
204 |
Q |
| |
|
||||| ||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
9060199 |
actagtgaaaagacgggtactcaagtgcccgtctttccgctctttt |
9060154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 21635119 - 21635070
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
|||||||||||||| || ||||| ||| ||||||||||||||||||||| |
|
|
| T |
21635119 |
actagcgaaaagattggcactcatgtgctcgtctttccgctctttttatt |
21635070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 34729457 - 34729408
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
||||||||||||| || ||||| |||||||||||||||| ||||||||| |
|
|
| T |
34729457 |
actagcgaaaagacgggcactcacgtgtccgtctttccgcactttttatt |
34729408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 221
Target Start/End: Complemental strand, 12170767 - 12170739
Alignment:
| Q |
193 |
ttccgctctttttattatgttaaagtttg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12170767 |
ttccgctctttttattatgttaaagtttg |
12170739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1613 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1613
Description:
Target: scaffold1613; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 352 - 402
Alignment:
| Q |
158 |
aactagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatt |
208 |
Q |
| |
|
||||||| |||||| || ||||||||||||||||||||| |||||||||| |
|
|
| T |
352 |
aactagcaaaaagaggggcactcaagtgtccgtctttccgatctttttatt |
402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0293 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0293
Description:
Target: scaffold0293; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 209
Target Start/End: Complemental strand, 4755 - 4705
Alignment:
| Q |
159 |
actagcgaaaagatcggtactcaagtgtccgtctttccgctctttttatta |
209 |
Q |
| |
|
||||||| ||||| || ||||| ||||||||||||||||||||||||||| |
|
|
| T |
4755 |
actagcgcaaagacaggcactcacgtgtccgtctttccgctctttttatta |
4705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0097 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0097
Description:
Target: scaffold0097; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 22137 - 22096
Alignment:
| Q |
163 |
gcgaaaagatcggtactcaagtgtccgtctttccgctctttt |
204 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
22137 |
gcgaaaagatcggcactcacgtgcccgtctttccgctctttt |
22096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 158 - 215
Target Start/End: Original strand, 21086 - 21143
Alignment:
| Q |
158 |
aactagcgaaaagatcggtactcaagtgtccgtctttccgctctttttattatgttaa |
215 |
Q |
| |
|
|||||||||||||| || ||||| || |||||||||||||||||||||| |||||| |
|
|
| T |
21086 |
aactagcgaaaagacgggcactcacatgcccgtctttccgctctttttattgtgttaa |
21143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University