View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_high_13 (Length: 358)
Name: NF3539_high_13
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 16 - 135
Target Start/End: Complemental strand, 22918031 - 22917909
Alignment:
| Q |
16 |
atgtttctttatgtaacaattgtattttgatgaattattcactttctgtttaatgtttgacttttactatt-aaagtttgctcatgatttacac--atgc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| ||||||||||| |||| |
|
|
| T |
22918031 |
atgtttctttatgtaacaattgtattttgatgaattattcactttctgattaatgtttgacttttactattaaaagtttgcttatgatttacacatatgc |
22917932 |
T |
 |
| Q |
113 |
tatttcaatcacccgggcggcag |
135 |
Q |
| |
|
||||||||| | ||||||||||| |
|
|
| T |
22917931 |
tatttcaatgatccgggcggcag |
22917909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 16 - 110
Target Start/End: Complemental strand, 43787260 - 43787166
Alignment:
| Q |
16 |
atgtttctttatgtaacaattgtattttgatgaattattcactttctgtttaatgtttgacttttactattaaagtttgctcatgatttacacat |
110 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
43787260 |
atgtttttttatataacaattgtattttgatgaattattcactttctgtttaatgtttgacttttactattaaagtttgcttttggtttacacat |
43787166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University