View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_high_14 (Length: 347)
Name: NF3539_high_14
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 247
Target Start/End: Complemental strand, 35235222 - 35234994
Alignment:
| Q |
19 |
agctcttcatatgcggcggcgatttcatcttcgtcttcgtctgggccgttgtctatggaaggtggtggaatgaagccttccgggatttccggtgggttga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35235222 |
agctcttcatatgcggcggcgatttcatcttcgtcttcgtctgggccgtcgtctatggaaggtggtggaatgaagccttccgggatttccggtgggttga |
35235123 |
T |
|
| Q |
119 |
agggaaggtcttcttctgggatggtgatgtcgaattcatcggaggtgggaattgctttgacggtgaaggaaattgtggagagagaaaatggggttttagt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35235122 |
agggaaggtcttcttctgggatggtgatgtcgaattcatcggaggtgggaattgctttgacggtgaaggaaattgtggagagagtgaatggggttttagt |
35235023 |
T |
|
| Q |
219 |
aagagggaatgtgagtttgtgggttgtgg |
247 |
Q |
| |
|
||| ||||||||||||||||||||||||| |
|
|
| T |
35235022 |
aagtgggaatgtgagtttgtgggttgtgg |
35234994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University