View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_high_19 (Length: 321)
Name: NF3539_high_19
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_high_19 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 284; Significance: 1e-159; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 26 - 321
Target Start/End: Complemental strand, 3594247 - 3593952
Alignment:
| Q |
26 |
atctcattggatttcagggatagaaataaatatgtcaaaggagatcgccgctttgaacgtgcctactgtagtcgtaatcccagagaaatgggaaaaacat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3594247 |
atctcattggatttcagggatagaaataaatatgtcaaaggagatcgccgctttgaacgtgcctactgtagtcgtaatcccagagaaatgggaaaaacat |
3594148 |
T |
|
| Q |
126 |
gggcagaaaaggaactcaagaatctttataggtttgcatatgctattttttcattctttcatatttttcgaatatacaagggttcaattactcattttgc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3594147 |
gggcagaaaaggaactcaagaatctttataggtttgcatatgctattttttcattctttcatatttttccaatatacaagggttcaattactcattttgc |
3594048 |
T |
|
| Q |
226 |
ctaagcttttctatatccgagtgcaggatagctgcaaaaggaattaggtgccctttaccgcgtcatcaaaagctacatatggtggtgatggatttt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3594047 |
ctaagcttttctatatccgagtgcaggatagctgcaaaaggaattaggtgccctaaaccgcgtcatcaaaagctacatatggtggtgatggatttt |
3593952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 39 - 181
Target Start/End: Complemental strand, 28934014 - 28933872
Alignment:
| Q |
39 |
tcagggatagaaataaatatgtcaaaggagatcgccgctttgaacgtgcctactgtagtcgtaatcccagagaaatgggaaaaacatgggcagaaaagga |
138 |
Q |
| |
|
||||||||||| || |||||| |||||||||||||| |||||| | |||||| | ||||||| || |||||| ||||||||||||||||||||| |
|
|
| T |
28934014 |
tcagggatagagctagatatgtgaaaggagatcgccggtttgaaaacgagtactgtgggtctaatccccgaaaaatggtaaaaacatgggcagaaaagga |
28933915 |
T |
|
| Q |
139 |
actcaagaatctttataggtttgcatatgctattttttcattc |
181 |
Q |
| |
|
| | ||||||| |||||||||| |||| ||||||||||| |
|
|
| T |
28933914 |
aaggagtaatctttcgaggtttgcatttgctcttttttcattc |
28933872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 100 - 179
Target Start/End: Original strand, 35714861 - 35714940
Alignment:
| Q |
100 |
taatcccagagaaatgggaaaaacatgggcagaaaaggaactcaagaatctttataggtttgcatatgctattttttcat |
179 |
Q |
| |
|
||||||| || |||||| ||||||||||||||||||||| ||| ||||||| | |||||||||| |||| || |||||| |
|
|
| T |
35714861 |
taatccccgaaaaatggttaaaacatgggcagaaaaggaattcaggaatcttaagaggtttgcatttgctcttatttcat |
35714940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 26 - 86
Target Start/End: Complemental strand, 8490590 - 8490531
Alignment:
| Q |
26 |
atctcattggatttcagggatagaaataaatatgtcaaaggagatcgccgctttgaacgtg |
86 |
Q |
| |
|
||||||||| || ||||||||||||| |||||||||||||||||| ||| ||||||||||| |
|
|
| T |
8490590 |
atctcattg-atatcagggatagaaaaaaatatgtcaaaggagattgccactttgaacgtg |
8490531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University