View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_high_24 (Length: 295)
Name: NF3539_high_24
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 111 - 279
Target Start/End: Complemental strand, 32961264 - 32961096
Alignment:
| Q |
111 |
atgttggtatactttgaaaccttatggatcactaccctcgtcaacaacaaaatcactagaccaatcccaaaccacctagccataaagctctctctttagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32961264 |
atgttggtatactttgaaaccttatggatcactaccctcgtcaacaacaaaatcactagaccaatcccaatccacctagccataaagctctctctttagt |
32961165 |
T |
 |
| Q |
211 |
ctcaatgaatctttgaaccacaaagagaaaaatgtccctagccccaagtgagaatgtgagataaagaca |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32961164 |
ctcaatgaatctttgaaccacaaagagaaaaatgtccctagccccaagtgagaatgtgagataaagaca |
32961096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 16 - 50
Target Start/End: Complemental strand, 32961359 - 32961325
Alignment:
| Q |
16 |
actgatactatgttggtccacccatacttctgata |
50 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
32961359 |
actgatgctatgttggtccacccatacttctgata |
32961325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University