View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_high_29 (Length: 272)
Name: NF3539_high_29
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 43 - 256
Target Start/End: Original strand, 51423706 - 51423919
Alignment:
| Q |
43 |
tatgtgtgttacctgcgatattggactggtataattccagctttgtattcagcaattttaagataagcaggtttggctaaatcaaagtgctcacgtggtg |
142 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51423706 |
tatgtatgttacctgcgatattggactggtataattccagctttgtattcagcaattttaagataagcaggtttggctaaatcaaagtgctcacgtggtg |
51423805 |
T |
 |
| Q |
143 |
ggttgcaccatcctccattctcacttgattgggcaaaattgggaggacaaaggtctgttgccgtcactttaatagaggcttgctctggcttacacccttg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51423806 |
ggttgcaccatcctccattctcacttgattgggcaaaattgggaggacaaaggtctgttgccgtcactttaatagaggcttgccctggcttacacccttg |
51423905 |
T |
 |
| Q |
243 |
aggagagtccacac |
256 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
51423906 |
aggagagtccacac |
51423919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University