View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_high_35 (Length: 250)
Name: NF3539_high_35
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_high_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 12 - 95
Target Start/End: Original strand, 13037568 - 13037652
Alignment:
| Q |
12 |
atgaagaaacacattgaaatttatagagtacgattttcttaaaataggaatttttttggttactgt-cattattgatccacacag |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13037568 |
atgaagaaacacattgaaatttatagagtaggattttcttaaaataggaatttttttggttactgtccattattgatccacacag |
13037652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 12 - 95
Target Start/End: Original strand, 13107576 - 13107660
Alignment:
| Q |
12 |
atgaagaaacacattgaaatttatagagtacgattttcttaaaataggaatttttttggttactgt-cattattgatccacacag |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13107576 |
atgaagaaacacattgaaatttatagagtaggattttcttaaaataggaatttttttggttactgtccattattgatccacacag |
13107660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University