View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3539_low_16 (Length: 358)

Name: NF3539_low_16
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3539_low_16
NF3539_low_16
[»] chr5 (1 HSPs)
chr5 (16-135)||(22917909-22918031)
[»] chr3 (1 HSPs)
chr3 (16-110)||(43787166-43787260)


Alignment Details
Target: chr5 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 16 - 135
Target Start/End: Complemental strand, 22918031 - 22917909
Alignment:
16 atgtttctttatgtaacaattgtattttgatgaattattcactttctgtttaatgtttgacttttactatt-aaagtttgctcatgatttacac--atgc 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |||||||||||  ||||    
22918031 atgtttctttatgtaacaattgtattttgatgaattattcactttctgattaatgtttgacttttactattaaaagtttgcttatgatttacacatatgc 22917932  T
113 tatttcaatcacccgggcggcag 135  Q
    ||||||||| | |||||||||||    
22917931 tatttcaatgatccgggcggcag 22917909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 16 - 110
Target Start/End: Complemental strand, 43787260 - 43787166
Alignment:
16 atgtttctttatgtaacaattgtattttgatgaattattcactttctgtttaatgtttgacttttactattaaagtttgctcatgatttacacat 110  Q
    |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  || |||||||||    
43787260 atgtttttttatataacaattgtattttgatgaattattcactttctgtttaatgtttgacttttactattaaagtttgcttttggtttacacat 43787166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University