View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_low_20 (Length: 331)
Name: NF3539_low_20
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 286
Target Start/End: Original strand, 29439206 - 29439468
Alignment:
| Q |
12 |
agagaagggtgtgaaaagatgatgagggtggtgcaaaaaaccaacttcagcaataaactccattaaacatgaagacaacaatggaatttgacagtgatga |
111 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29439206 |
agagaagggtgtgaaaaggtgatgagggtggtgcaaaaaaccaacttcagcaataaactccattaa-catgaagacaacaatggaatttgaca------- |
29439297 |
T |
 |
| Q |
112 |
ggagacacgagttcatgagtttgtgttagcacaaagagtggagtgtgtgaagaaatgaagaggtttggataaaagatagggattcggattcaataacttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
29439298 |
-------cgagttcatgagtttgtgttagcacaaagagtggagtgtgtgaagaaatgaagaggtttggataaaatatagggatccggattcaataacttt |
29439390 |
T |
 |
| Q |
212 |
t-gggtgggaaaagttatgtgactttgttc--tatccaccattggtttaatctcttggttcagattttgacacttgtt |
286 |
Q |
| |
|
| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29439391 |
tagggtgggaaaagttatgtgactttgttcaatatccaccattggtttaatctcttggttcagattttgacacatgtt |
29439468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 280
Target Start/End: Original strand, 5430936 - 5431027
Alignment:
| Q |
191 |
ggattcggattcaataacttttgggtgggaaaagttatgtgactttgttc--tatccaccattggtttaatctcttggttcagattttgaca |
280 |
Q |
| |
|
|||| |||||||||| ||||||| | |||||||||||||||||||| || |||||||||||||||||| | ||| |||||||||||||| |
|
|
| T |
5430936 |
ggatccggattcaatgacttttgagagggaaaagttatgtgactttagtcaatatccaccattggtttaaccctttgcttcagattttgaca |
5431027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 191 - 286
Target Start/End: Original strand, 36008935 - 36009032
Alignment:
| Q |
191 |
ggattcggattcaataacttttgggtgggaaaagttatgtgactttgttc--tatccaccattggtttaatctcttggttcagattttgacacttgtt |
286 |
Q |
| |
|
|||| |||||||| ||||||| ||||||||||||||| ||||||||||| |||| | |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36008935 |
ggatccggattcagcaactttttggtgggaaaagttatatgactttgttcaatatctatcattggtttaatctcttggttcagattttgacacatgtt |
36009032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 245 - 286
Target Start/End: Complemental strand, 36009730 - 36009689
Alignment:
| Q |
245 |
caccattggtttaatctcttggttcagattttgacacttgtt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36009730 |
caccattggtttaatctcttggttcagattttgacacatgtt |
36009689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 190 - 286
Target Start/End: Original strand, 41976760 - 41976858
Alignment:
| Q |
190 |
gggattcggattcaataacttttgggtgggaaaagttatgtgactttgttc--tatccaccattggtttaatctcttggttcagattttgacacttgtt |
286 |
Q |
| |
|
||||| |||||||| |||||||| |||||||||||| || |||||||| || |||||||||||| ||||||| |||||||||||||| |||| |||| |
|
|
| T |
41976760 |
gggatccggattcagtaactttttggtgggaaaagtcatatgactttgctcaatatccaccattgaattaatcttttggttcagattttaacacatgtt |
41976858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 237
Target Start/End: Complemental strand, 34607149 - 34607104
Alignment:
| Q |
192 |
gattcggattcaataacttttgggtgggaaaagttatgtgactttg |
237 |
Q |
| |
|
||||| |||||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
34607149 |
gattcagattcagtaacttttgggagggaaaagttatgagactttg |
34607104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 286
Target Start/End: Original strand, 51326793 - 51326838
Alignment:
| Q |
241 |
tatccaccattggtttaatctcttggttcagattttgacacttgtt |
286 |
Q |
| |
|
|||| |||||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
51326793 |
tatctaccattagtttaatcttttggttcagattttgacacatgtt |
51326838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University