View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_low_32 (Length: 274)
Name: NF3539_low_32
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_low_32 |
 | |
|
| [»] scaffold0426 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0426 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: scaffold0426
Description:
Target: scaffold0426; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 11 - 258
Target Start/End: Complemental strand, 6956 - 6709
Alignment:
| Q |
11 |
aagaacttttagccggaatcactttcggaagcattttgattattaacttttcagagatcaaaataaaaaacaaattttgtatcttaaccgtcttcatgtt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6956 |
aagaacttttagccggaatcactttcggaagcattttgattattaacttttcagagatcaaaataaaaaacaaattttgtatcttaaccgtcttcatgtt |
6857 |
T |
|
| Q |
111 |
atcaatatatttaaccctttttctgaagtagctataaaaactgcaacatgtaattgacaatgggagaacattgttatttgaaaattaacgcaaagtgcaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6856 |
atcaatatatttaaccctttttctgaagtagctataaaaactgcaacatgtaattgacaatgggagaacattgttatttgaaaattaacgcaaagtgcaa |
6757 |
T |
|
| Q |
211 |
ctcataattacttataagaaataacataaagaaatacattctcaaagg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6756 |
ctcataattacttataagaaataacataaagaaatacatcctcaaagg |
6709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 76
Target Start/End: Complemental strand, 14789845 - 14789786
Alignment:
| Q |
17 |
ttttagccggaatcactttcggaagcattttgattattaacttttcagagatcaaaataa |
76 |
Q |
| |
|
|||||||| ||| ||||||| |||||||||||||||| ||||||| ||| ||||| |||| |
|
|
| T |
14789845 |
ttttagccagaagcactttctgaagcattttgattataaactttttagaaatcaagataa |
14789786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 76
Target Start/End: Original strand, 2705238 - 2705297
Alignment:
| Q |
17 |
ttttagccggaatcactttcggaagcattttgattattaacttttcagagatcaaaataa |
76 |
Q |
| |
|
|||||||| ||| ||||||| |||||||||||||||| ||||||| ||| ||||| |||| |
|
|
| T |
2705238 |
ttttagccagaagcactttctgaagcattttgattataaactttttagaaatcaagataa |
2705297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University