View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_low_36 (Length: 255)
Name: NF3539_low_36
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 26901861 - 26902090
Alignment:
| Q |
18 |
agcagaattaaattacagttaattattgacgaaagtagttagttagttatcaggtacggcggcggatcctcaccggagatttgtagaaatgcatgatcga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26901861 |
agcagaattaaattacagttaattattgacgaaagtagttagttagttatccggtacggcggcggatcctcaccggagatttgtagaaatgcatgatcga |
26901960 |
T |
 |
| Q |
118 |
cggactgagatattccctacgcttcgcgagaacgtggtctccggaaggaccggaatacgatggcggaacgtaatcgaacggtggaagcaccggtggttcg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26901961 |
cggactgagatattccctacgcttcgcgagaacgtggtcgccggaaggaccggaatacgatggcggaacgtaatcgaacggtggaagcaccggtggttcg |
26902060 |
T |
 |
| Q |
218 |
gcggcgacgatgtctttggttctctctgct |
247 |
Q |
| |
|
||||||||| ||||||||||||| |||||| |
|
|
| T |
26902061 |
gcggcgacgttgtctttggttctttctgct |
26902090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University