View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3539_low_36 (Length: 255)

Name: NF3539_low_36
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3539_low_36
NF3539_low_36
[»] chr7 (1 HSPs)
chr7 (18-247)||(26901861-26902090)


Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 26901861 - 26902090
Alignment:
18 agcagaattaaattacagttaattattgacgaaagtagttagttagttatcaggtacggcggcggatcctcaccggagatttgtagaaatgcatgatcga 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
26901861 agcagaattaaattacagttaattattgacgaaagtagttagttagttatccggtacggcggcggatcctcaccggagatttgtagaaatgcatgatcga 26901960  T
118 cggactgagatattccctacgcttcgcgagaacgtggtctccggaaggaccggaatacgatggcggaacgtaatcgaacggtggaagcaccggtggttcg 217  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26901961 cggactgagatattccctacgcttcgcgagaacgtggtcgccggaaggaccggaatacgatggcggaacgtaatcgaacggtggaagcaccggtggttcg 26902060  T
218 gcggcgacgatgtctttggttctctctgct 247  Q
    ||||||||| ||||||||||||| ||||||    
26902061 gcggcgacgttgtctttggttctttctgct 26902090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University