View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_low_49 (Length: 238)
Name: NF3539_low_49
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_low_49 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 40804399 - 40804176
Alignment:
| Q |
15 |
agttcgaatcttggctggaaaaatccttggccaagttttgcataacccctgccgaagtccaaattaccagagtccccttcccctatgaaccggagggttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40804399 |
agttcgaatcttggctggaaaaatccttggccaagttttgcataacccctgccgaagtccaaattaccagagtccccttcccctatgaaccggaggattt |
40804300 |
T |
|
| Q |
115 |
agactttagaccnnnnnnnggaatccattttaaggttttttgtgaaactctgatctcagtaattagttgcaatggttgctatatattttgaaagaataca |
214 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40804299 |
agactttagaccaaaaaaaggaatccattttaaggttttttgtgaaactctgatctccgtaattagttgcaatggttgctatatattttgaaagaataca |
40804200 |
T |
|
| Q |
215 |
ttttcgctatgattttttatggtc |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40804199 |
ttttcgctatgattttttatggtc |
40804176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University