View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_low_50 (Length: 237)
Name: NF3539_low_50
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_low_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 8 - 215
Target Start/End: Original strand, 13108233 - 13108440
Alignment:
| Q |
8 |
cagcttagtcggtatgtctatgatgtctgtcttttctcttagttcacgaaaaaacaattttgatgtcattcccagaaggtggtcattggtgtggcttgtg |
107 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13108233 |
cagcttagtcagtatgtctatgatgtttgtcttttctcttagttcacgaaaaaacaattttgatgtcattcccagaaggtggtcattggtgtggcctgtg |
13108332 |
T |
 |
| Q |
108 |
tatcggatgccatgagtgatattattgtctagacggcattgcaagcaatgtctcttctagttagacacatcctattttgcatcaaagtaggtggtatcaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13108333 |
tatcggatgccatgagtgatattattgtctagagggcattgcaagcaatgtctcttttagttagacacatcctattttgcatcaaagtaggtggtatcaa |
13108432 |
T |
 |
| Q |
208 |
ataagctt |
215 |
Q |
| |
|
|||||||| |
|
|
| T |
13108433 |
ataagctt |
13108440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 212
Target Start/End: Original strand, 13038225 - 13038429
Alignment:
| Q |
8 |
cagcttagtcggtatgtctatgatgtctgtcttttctcttagttcacgaaaaaacaattttgatgtcattcccagaaggtggtcattggtgtggcttgtg |
107 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13038225 |
cagcttagtcagtatgtctatgatgtttgtcttttctcttagttcacgaaaaaacaattttgatgtcattcccagaaggtggtcattggtgtggcctgtg |
13038324 |
T |
 |
| Q |
108 |
tatcggatgccatgagtgatattattgtctagacggcattgcaagcaatgtctcttctagttagacacatcctattttgcatcaaagtaggtggtatcaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13038325 |
tatcggatgccatgagtgatattattgtctagagggcattgcaagcaatgtctcttttagttagacacatcctattttgcatcaaagtaggtggtatcaa |
13038424 |
T |
 |
| Q |
208 |
ataag |
212 |
Q |
| |
|
||||| |
|
|
| T |
13038425 |
ataag |
13038429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 59 - 112
Target Start/End: Complemental strand, 50269688 - 50269635
Alignment:
| Q |
59 |
aaacaattttgatgtcattcccagaaggtggtcattggtgtggcttgtgtatcg |
112 |
Q |
| |
|
||||||||||| ||||||||| ||||| |||||| ||||||||||||||||||| |
|
|
| T |
50269688 |
aaacaattttggtgtcattcctagaagatggtcaatggtgtggcttgtgtatcg |
50269635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University