View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_low_52 (Length: 236)
Name: NF3539_low_52
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 20994460 - 20994691
Alignment:
| Q |
1 |
gcttgaagctagcgaggttacaaaatccttgactagttagcatgcacttttgttaatgcgttgttat----------tttattattttgatccaatcaaa |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | ||||||| ||||||||||||||||||||||| |
|
|
| T |
20994460 |
gcttgaagctagcgaggttacaaaatccttgactagttagcaagcacttttgttaatactttgttattttattttattttattattttgatccaatcaaa |
20994559 |
T |
|
| Q |
91 |
ttgcattatgttcacaagcaaatatttttgggttagttatttattgtcttattttattaaggtgtgggaggtgaaagctgcagacctgaccattagccct |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20994560 |
ttgcattatgttcacaagcaaatatttttgggttagttatttattgtcttattttattaaggtgtgggaggtgaaagctgcagacctgaccattagccct |
20994659 |
T |
|
| Q |
191 |
gtttaccgagctgcagagggcaaagtagattc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20994660 |
gtttaccgagctgcagagggcaaagtagattc |
20994691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 131 - 222
Target Start/End: Original strand, 21004745 - 21004836
Alignment:
| Q |
131 |
ttattgtcttattttattaaggtgtgggaggtgaaagctgcagacctgaccattagccctgtttaccgagctgcagagggcaaagtagattc |
222 |
Q |
| |
|
||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||||||| |
|
|
| T |
21004745 |
ttattttcttatttcatttaggtgtgggaggtgaaagctgcagacctgaccattagccccgtttaccgagctgcagtgggcatagtagattc |
21004836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 150 - 222
Target Start/End: Complemental strand, 24770773 - 24770701
Alignment:
| Q |
150 |
aggtgtgggaggtgaaagctgcagacctgaccattagccctgtttaccgagctgcagagggcaaagtagattc |
222 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||| ||||| |||||||| ||| |||||| |||| |
|
|
| T |
24770773 |
aggtgtgggaggtgaaagtttcagacctgaccattagccctgattaccaagctgcagtggggaaagtacattc |
24770701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University