View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_low_53 (Length: 236)
Name: NF3539_low_53
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 42682874 - 42683095
Alignment:
| Q |
1 |
atcaagaatggaacaagccaacccagggattaaggacatggattatnnnnnnnn-gtgacaaatacaagaatgatcaattatgcaacatcttgatccaaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42682874 |
atcaagaatggaacaagccaacccagggattaagaacatggattataaaaaaaaagtgacaaatacaagaatggtcaattatgcaacatcttgatccaaa |
42682973 |
T |
|
| Q |
100 |
tcgtgaacatcttaacattgtttgtttcaattgcaatattggtttttggtttaaggatatggaataccagacaagctaacacagaatgtgagatttctct |
199 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42682974 |
tcgtgaacgtcttaacattgtttgtttcaattgcaatattggtttttggtttaaggatatggaataccagacaagctaacacagaatgtgagatttctct |
42683073 |
T |
|
| Q |
200 |
actgggtctcataggtgtctgt |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42683074 |
actgggtctcataggtgtctgt |
42683095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University