View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_low_54 (Length: 232)
Name: NF3539_low_54
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 7 - 220
Target Start/End: Original strand, 47198102 - 47198315
Alignment:
| Q |
7 |
ataatagcattaattattaataatgaatcattttaatgcataatgcagccgaatcaatgttaaaatattaaaccaaatacatgaatttttattatgttta |
106 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47198102 |
ataatagcattaattattaatcatgaatcattttaatgcataatgcagtcgaatcaatgttaaaatattaaaccaaatacataaatttttattatgttta |
47198201 |
T |
|
| Q |
107 |
attatgtacaggtcttccagcaatgcaccggcatcagtgcaatcatgttctatgctccagtattgttcagcactctgggatttcacaatgatgcttcact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47198202 |
attatgtacaggtcttccagcaatgcaccggcatcaatgcaatcatgttctatgctccagtattgttcagcactctgggatttcacaatgatgcttcact |
47198301 |
T |
|
| Q |
207 |
ttactcatcagtga |
220 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47198302 |
ttactcatcagtga |
47198315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 116 - 220
Target Start/End: Original strand, 47185672 - 47185776
Alignment:
| Q |
116 |
aggtcttccagcaatgcaccggcatcagtgcaatcatgttctatgctccagtattgttcagcactctgggatttcacaatgatgcttcactttactcatc |
215 |
Q |
| |
|
|||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47185672 |
aggtcttccaacaattcaccggcatcaatgcaatcatgttctatgctccagtattgttcaacactttgggatttcacaatgatgcttcactttactcatc |
47185771 |
T |
|
| Q |
216 |
agtga |
220 |
Q |
| |
|
||||| |
|
|
| T |
47185772 |
agtga |
47185776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 212
Target Start/End: Original strand, 47212308 - 47212396
Alignment:
| Q |
124 |
cagcaatgcaccggcatcagtgcaatcatgttctatgctccagtattgttcagcactctgggatttcacaatgatgcttcactttactc |
212 |
Q |
| |
|
||||||| ||| ||||||| ||| || ||||||||||||||||| |||||| ||| | |||||| | ||||||||| |||||||||| |
|
|
| T |
47212308 |
cagcaattcactggcatcaatgcgataatgttctatgctccagttctgttcaacaccttaggatttaagaatgatgctgcactttactc |
47212396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University