View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_low_56 (Length: 215)
Name: NF3539_low_56
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_low_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 24914082 - 24913878
Alignment:
| Q |
1 |
tttcaatcttatatctatattgtttgcattcttaacccatggctgtaatacttaccgatatcannnnnnnncgtttctttgctagttcatggagcatgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||| |
|
|
| T |
24914082 |
tttcaatcttatatctatattgtttgcattcttaacccatggctgtaatacttaccgat--cattttttt-cgtttctttgctagttcacggagcatgag |
24913986 |
T |
 |
| Q |
101 |
atcaattttttcggccaatttttgcatgagtaagttgtcaacagtttttagttgttt---attactattagtctatttataataaagcatagcagtacaa |
197 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24913985 |
atcaaatttttcggccaatttttgcatgagtaagttgtcaacagtttttagttgtttattattattattagtctatttataataaagcatagcagttcaa |
24913886 |
T |
 |
| Q |
198 |
gtcctatg |
205 |
Q |
| |
|
|||||||| |
|
|
| T |
24913885 |
gtcctatg |
24913878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 130 - 199
Target Start/End: Complemental strand, 24913751 - 24913682
Alignment:
| Q |
130 |
gtaagttgtcaacagtttttagttgtttattactattagtctatttataataaagcatagcagtacaagt |
199 |
Q |
| |
|
||||||||| |||||||||||||||||||| | ||||||||||| ||||||||||||||| | ||||||| |
|
|
| T |
24913751 |
gtaagttgtaaacagtttttagttgtttataaatattagtctatctataataaagcatagtattacaagt |
24913682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University