View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3539_low_58 (Length: 201)
Name: NF3539_low_58
Description: NF3539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3539_low_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 11 - 182
Target Start/End: Original strand, 23226899 - 23227070
Alignment:
| Q |
11 |
gtgagaagaaaggaggagggagaaagagtttgaagttgcttgaggaaccaatttggaggtcttattgtaatggaagaaaatgtggttatgcttataggca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23226899 |
gtgagaagaaaggaggagggagaaagagtttgaagttgcttgaggaaccaatttggaggtcttattgtaatggaagaaaatgtggttatgcttataggca |
23226998 |
T |
 |
| Q |
111 |
tgaatgtggatcagaggaatggaagatattgaaagctgtcgaacctatttcaatgggtgctggtgtgttgcc |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23226999 |
tgaatgtggatcagaggaatggaagatattgaaagctgtggaacctatttcaatgggtgctggtgtgttgcc |
23227070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 182
Target Start/End: Original strand, 46089720 - 46089768
Alignment:
| Q |
134 |
agatattgaaagctgtcgaacctatttcaatgggtgctggtgtgttgcc |
182 |
Q |
| |
|
|||| ||||||||||| || ||||||||||||||||||||||| ||||| |
|
|
| T |
46089720 |
agattttgaaagctgttgagcctatttcaatgggtgctggtgttttgcc |
46089768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University