View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3540_high_5 (Length: 367)
Name: NF3540_high_5
Description: NF3540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3540_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 109 - 338
Target Start/End: Original strand, 34899746 - 34899975
Alignment:
| Q |
109 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcacgtttggtgagaatggaaggaaaattttgagactata |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899746 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
34899845 |
T |
 |
| Q |
209 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899846 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
34899945 |
T |
 |
| Q |
309 |
gtttggtagtttcaactttcaagttgagat |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34899946 |
gtttggtagtttcaactttcaagttgagat |
34899975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 35111526 - 35111486
Alignment:
| Q |
1 |
attaagaatttctgcagtcctgtagcagacgacacaggttc |
41 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35111526 |
attaagaatttctgcagtcctgcagcagacgacacaggttc |
35111486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University