View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3541_low_5 (Length: 253)
Name: NF3541_low_5
Description: NF3541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3541_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 11 - 186
Target Start/End: Complemental strand, 14762808 - 14762630
Alignment:
| Q |
11 |
cagagattggaaggcttgtatctgtgacaggagttgtaacaaggacaagtgaggttcgacccgagcttctccatggaaccttcaaatgcctagaatgtgg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14762808 |
cagagattggaaggcttgtatctgtgacaggagttgtaacaaggacaagtgaggttcgaccggagcttctccatggaaccttcaaatgcctagaatgtgg |
14762709 |
T |
|
| Q |
111 |
tgggatgataaagaatgtag---aacagttcaagtatactgaggtgattaacagacaattaatgttattttagttcttg |
186 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14762708 |
tgggatgataaagaatgtagaacaacagttcaagtatactgaggtgattaacagacaattaatgttattttagttcttg |
14762630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 11 - 152
Target Start/End: Complemental strand, 37649596 - 37649452
Alignment:
| Q |
11 |
cagagattggaaggcttgtatctgtgacaggagttgtaacaaggacaagtgaggttcgacccgagcttctccatggaaccttcaaatgcctagaatgtgg |
110 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||| ||||| ||||| || ||||||||||| |
|
|
| T |
37649596 |
cagagattggtaggcttgtatctgtaacaggagtggtaacaaggacaagtgaggttcgacctgagcttctccaaggaactttcaagtgtctagaatgtgg |
37649497 |
T |
|
| Q |
111 |
tgggatgataaagaatgtagaacag---ttcaagtatactgaggt |
152 |
Q |
| |
|
|||| | ||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
37649496 |
tggggttataaagaatgttgaacagcaattcaagtatactgaggt |
37649452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University