View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3541_low_6 (Length: 250)
Name: NF3541_low_6
Description: NF3541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3541_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 5 - 241
Target Start/End: Complemental strand, 12861040 - 12860804
Alignment:
| Q |
5 |
ttgccaattggctatgtttctgctttctatcactaatcactatgttgagcatactatggttagcaaagggctataggtctctcgttcttttcatgatcat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12861040 |
ttgccaattggctatgtttctgctttctatcactaatcactatgttgagcatactacggttagcaaagggctataggtctctcgttcttttcatgttcat |
12860941 |
T |
 |
| Q |
105 |
gagtttaaggaagctatgttttctatacaccgaaataaaagctcagttaacgtcaggctggacgtgtgttctcagatgtcaaaatttagtgttgcatctt |
204 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12860940 |
gagtttaaggaagttatgttttctatacaccgaaataaaagctcagttaacgtcaggttgggcgtgtgttctcagatgtcaaattttagtgttgcatctt |
12860841 |
T |
 |
| Q |
205 |
catggttgcctctttggttgaggtgttggttctctgc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12860840 |
catggttgcctctttggttgaggtgttggttctctgc |
12860804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 145 - 240
Target Start/End: Original strand, 12833135 - 12833230
Alignment:
| Q |
145 |
gctcagttaacgtcaggctggacgtgtgttctcagatgtcaaaatttagtgttgcatcttcatggttgcctctttggttgaggtgttggttctctg |
240 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||| |||||| ||||||||| ||||||||||||||| | ||||| |||||||||| |
|
|
| T |
12833135 |
gctcggttaacgtcaggctgggcgtgtgttctcagatgtcaaattttagttttgcatctttgtggttgcctctttggctaaggtgctggttctctg |
12833230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 45 - 133
Target Start/End: Original strand, 12844507 - 12844595
Alignment:
| Q |
45 |
tatgttgagcatactatggttagcaaagggctataggtctctcgttcttttcatgatcatgagtttaaggaagctatgttttctataca |
133 |
Q |
| |
|
|||||||||||||||| |||||||| | |||||||||||| | |||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12844507 |
tatgttgagcatactacggttagcacaaggctataggtctttggttcatttcagattcatgagtttaaggaagctatgttttctataca |
12844595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University