View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3541_low_7 (Length: 240)
Name: NF3541_low_7
Description: NF3541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3541_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 233
Target Start/End: Complemental strand, 43815269 - 43815056
Alignment:
| Q |
20 |
cttgcaagtacaagatcatctttccatagcaccactagttccttaccctcaggtgacgacacaaatctactagatcatccattttcatcttctgctaagt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43815269 |
cttgcaagtacaagatcatctttccatagcaccactagttccttaccctcaggtgacgatacaaatctactagatcatccattttcttcttctgctaagt |
43815170 |
T |
 |
| Q |
120 |
tcaaaacttcagggagtcctgattcagatatccatgcaaacattgtgttgcctcaaccaaagtagatgatggaattcaaatctcatgaacaatgatgatc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43815169 |
tcaaaacttcagggagtcctgattcagatatccatgcaaacattgtgttgcctcaaccaaagtagatgatggaattcaaatatcatgaacaatgatgatc |
43815070 |
T |
 |
| Q |
220 |
aaagaggggcatat |
233 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43815069 |
aaagaggggcatat |
43815056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University