View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3541_low_8 (Length: 239)
Name: NF3541_low_8
Description: NF3541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3541_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 14762393 - 14762174
Alignment:
| Q |
1 |
ttcttcgtcatgagattgtcgaacatgccagggctggtgacacgtgagatttcccttgtccctagtctgcttgaactgatcaaatcatagtaaaatttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
14762393 |
ttcttcgtcatgagattgtcgaacatgccagggctggtgacacgtgagatttcccttgtccctagtctgcttgaactgatcaaatcatagtaaaattcaa |
14762294 |
T |
|
| Q |
101 |
gtgttcatttataaataatcaaccgcaatctgtcttcttgtagggcgatttttacgggtactgtagttgttatacctgatatattggcattggcgtgccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14762293 |
gtgttcatttataaataatcaaccgcaatctgtcttcttgtagggcgatttttacgggtactgtagttgttatacctgatatattggcattggcgtgccc |
14762194 |
T |
|
| Q |
201 |
tggacagagggcagaatacc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
14762193 |
tggacagagggcagaatacc |
14762174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 37649183 - 37649126
Alignment:
| Q |
1 |
ttcttcgtcatgagattgtcgaacatgccagggctggtgacacgtgagatttcccttg |
58 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||| |||| |||| |
|
|
| T |
37649183 |
ttcttcgtcatgagattgtagaacatgctagggctggtgacacgtgagttttctcttg |
37649126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 142 - 203
Target Start/End: Complemental strand, 37649032 - 37648971
Alignment:
| Q |
142 |
agggcgatttttacgggtactgtagttgttatacctgatatattggcattggcgtgccctgg |
203 |
Q |
| |
|
|||| ||||||||| || |||||| |||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
37649032 |
agggtgatttttactggaactgtaattgtcatacctgatatattggcgttggcgtcccctgg |
37648971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University