View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3543_high_11 (Length: 217)

Name: NF3543_high_11
Description: NF3543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3543_high_11
NF3543_high_11
[»] chr4 (1 HSPs)
chr4 (19-205)||(51214589-51214775)
[»] chr3 (1 HSPs)
chr3 (18-148)||(49735391-49735521)


Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 205
Target Start/End: Original strand, 51214589 - 51214775
Alignment:
19 tagtcagtggaactggttttgggttagcaatcttctttctgttttgtgtctatgcaatcagtttttatgctggcgcccaacttattgagaatggcaaaac 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51214589 tagtcagtggaactggttttgggttagcaatcttctttctgttttgtgtctatgcaatcagtttttatgctggcgcccaacttattgagaatggcaaaac 51214688  T
119 ttcgatgtcaggagtttttcaagtaagttacggtcccaactcggaggccatttcagatatagtgctctttggttgaactctgtgctc 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
51214689 ttcgatgtcaggagtttttcaagtaagttacggtcccaactcggaggccatttcagatatagtgctctttggttgaactctgagctc 51214775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 18 - 148
Target Start/End: Complemental strand, 49735521 - 49735391
Alignment:
18 atagtcagtggaactggttttgggttagcaatcttctttctgttttgtgtctatgcaatcagtttttatgctggcgcccaacttattgagaatggcaaaa 117  Q
    ||||| ||||||  ||||||||| ||| ||||||||||| |||| ||||| ||||||  ||||||||||||||| || |||||| || ||||||||||||    
49735521 atagttagtggagttggttttggcttatcaatcttctttatgttctgtgtttatgcatgcagtttttatgctggagcacaacttgttaagaatggcaaaa 49735422  T
118 cttcgatgtcaggagtttttcaagtaagtta 148  Q
    | || || ||||  |||||||||||||||||    
49735421 cctcaatatcagatgtttttcaagtaagtta 49735391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University