View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3543_high_11 (Length: 217)
Name: NF3543_high_11
Description: NF3543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3543_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 205
Target Start/End: Original strand, 51214589 - 51214775
Alignment:
| Q |
19 |
tagtcagtggaactggttttgggttagcaatcttctttctgttttgtgtctatgcaatcagtttttatgctggcgcccaacttattgagaatggcaaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51214589 |
tagtcagtggaactggttttgggttagcaatcttctttctgttttgtgtctatgcaatcagtttttatgctggcgcccaacttattgagaatggcaaaac |
51214688 |
T |
|
| Q |
119 |
ttcgatgtcaggagtttttcaagtaagttacggtcccaactcggaggccatttcagatatagtgctctttggttgaactctgtgctc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51214689 |
ttcgatgtcaggagtttttcaagtaagttacggtcccaactcggaggccatttcagatatagtgctctttggttgaactctgagctc |
51214775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 18 - 148
Target Start/End: Complemental strand, 49735521 - 49735391
Alignment:
| Q |
18 |
atagtcagtggaactggttttgggttagcaatcttctttctgttttgtgtctatgcaatcagtttttatgctggcgcccaacttattgagaatggcaaaa |
117 |
Q |
| |
|
||||| |||||| ||||||||| ||| ||||||||||| |||| ||||| |||||| ||||||||||||||| || |||||| || |||||||||||| |
|
|
| T |
49735521 |
atagttagtggagttggttttggcttatcaatcttctttatgttctgtgtttatgcatgcagtttttatgctggagcacaacttgttaagaatggcaaaa |
49735422 |
T |
|
| Q |
118 |
cttcgatgtcaggagtttttcaagtaagtta |
148 |
Q |
| |
|
| || || |||| ||||||||||||||||| |
|
|
| T |
49735421 |
cctcaatatcagatgtttttcaagtaagtta |
49735391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University